Cep76^em1Mkob
Endonuclease-mediated Allele Detail

Summary

• Symbol: Cep76^em1Mkob
• Name: centrosomal protein 76; endonuclease-mediated mutation 1, Moira O'Bryan
• MGI ID: MGI:8217381
• Gene: Cep76 Location: Chr18:67750870-67774406 bp, - strand Genetic Position: Chr18, 40.04 cM
• Alliance: Cep76^em1Mkob page

Mutation origin

• Strain of Origin: C57BL/6J

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details:

  CRISPR/Cas9-mediated recombination deleted exon 3 using upstream gRNA TTTAAAACTCAGTTCGTGGT and downstream gRNA GGTCTACATAGTAAAGTTCT, leading to a premature stop codon in exon 4 and a truncated protein. The smaller second transcript encoding exons 5-12 is not targeted and should not be affected. (J:104190, J:392670)

• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

1 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Cep76 Mutation: 39 strains or lines available

References

• Original: J:104190 The Australian Phenomics Facility at The Australian National University, Heritable mouse mutants from the ENU mutagenesis program at the Australian Phenomics Facility at The Australian National University. MGI Direct Data Submission. 2006-2014
• All: 2 reference(s)