About   Help   FAQ
Pgrem1(icre/ERT2)Fjd
Endonuclease-mediated Allele Detail
Summary
Symbol: Pgrem1(icre/ERT2)Fjd
Name: progesterone receptor; endonuclease-mediated mutation 1, Franco J DeMayo
MGI ID: MGI:8216689
Synonyms: PgriCreERT2
Gene: Pgr  Location: Chr9:8899834-8968612 bp, + strand  Genetic Position: Chr9, 2.46 cM
Alliance: Pgrem1(icre/ERT2)Fjd page
Mutation
origin
Germline Transmission:  Earliest citation of germline transmission: J:368606
Parent Cell Line:  G4 (ES Cell)
Strain of Origin:  (129S6/SvEvTac x C57BL/6NCrl)F1
Mutation
description
Allele Type:    Endonuclease-mediated (Inducible, Null/knockout, Recombinase)
Inducer:    tamoxifen
Mutation:    Insertion
 
Pgrem1(icre/ERT2)Fjd expression driven by 1 gene
 
Mutation detailsA single guide (sgRNA) (GCTGTTGCTCCCTACCTCGGGG) was designed to replace exon 1 of the progesterone receptor (Pgr) with a codon-improved icre/ERT2 fusion gene (an icre recombinase fused to a human estrogen receptor ligand binding domain). (J:368606)
Recombinase
activity
Activity:
 Tissue activity of this recombinase allele
Driver: Pgr (mouse)
Summary of all recombinase alleles driven by Pgr.
 

Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Pgr Mutation:  76 strains or lines available
References
Original:  J:368606 Quiroz E, et al., A Mouse Model Engineered to Spatiotemporally Control Cre Expression in Progesterone Receptor Positive Cells. Biol Reprod. 2025 May 23;
All:  2 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/24/2026
MGI 6.24
The Jackson Laboratory