Cdca4em1(IMPC)Mbp
Endonuclease-mediated Allele Detail
|
|
| Symbol: |
Cdca4em1(IMPC)Mbp |
| Name: |
cell division cycle associated 4; endonuclease-mediated mutation 1, Mouse Biology Program, UC Davis |
| MGI ID: |
MGI:8215458 |
| Gene: |
Cdca4 Location: Chr12:112783849-112793043 bp, - strand Genetic Position: Chr12, 61.2 cM, cytoband F2
|
| Alliance: |
Cdca4em1(IMPC)Mbp page
|
| IMPC: |
Cdca4 gene page |
|
|
|
| Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
| Mutation: |
|
Deletion
|
| |
|
Mutation details:
This allele was generated at University of California, Davis using Cas9 and guides with spacer sequences AACCTCTCAGATAGTGTCTC and CGGCCGGGTGTTTACATGAG that targeted exon(s) ENSMUSE00000417012.5 ENSMUSE00001417930.2. This resulted in deletion(s) of 1287 bp (location: Chr12:112784546-112785832; GRCm39). This description was generated automatically. Additional molecular information including FASTA sequence support for this allele can be found here: (IMPC Gene page) and viewed in a genome context here: (IMPC Genome Browser). (J:384794)
|
| Inheritance: |
|
Not Specified |
|
|
|
|
| Original: |
J:265051 MGI and IMPC, MGI Load of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). Database Release. 2018-2023; |
| All: |
2 reference(s) |
|