Inhba^em3Iimcb
Endonuclease-mediated Allele Detail

Summary

• Symbol: Inhba^em3Iimcb
• Name: inhibin beta-A; endonuclease-mediated mutation 3, International Institute of Molecular and Cellular Biology in Warsaw
• MGI ID: MGI:8215002
• Gene: Inhba Location: Chr13:16186436-16206206 bp, + strand Genetic Position: Chr13, 5.85 cM
• Alliance: Inhba^em3Iimcb page

Mutation origin

• Strain of Origin: (C57BL/6JTar x CBA/WTar)F1

Mutation description

• Allele Type: Endonuclease-mediated (Conditional ready, No functional change)
• Mutation: Insertion
• Mutation details: CRISPR/Cas9 method by using two gRNAs flanking the coding region of exon 2 of the Inhba gene. LoxP sites were inserted using a long dsDNA donor. Target gRNA 1 sequence [PAM]: atacaggattgggtagcgat [GGG]. Target gRNA 2 sequence [PAM]: TCGCCAGGTCCCAGAGAAAA [TGG]. Additionally, sequences for the BamHI and HindIII restriction enzymes were inserted to facilitate genotyping. (J:368243)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Inhba Mutation: 30 strains or lines available

References

• Original: J:368243 Winek E, Direct Data Submissions from the International Institute of Molecular and Cellular Biology in Warsaw. MGI Direct Data Submission. 2025
• All: 1 reference(s)