Sox17^em1Isct
Endonuclease-mediated Allele Detail

Summary

• Symbol: Sox17^em1Isct
• Name: SRY (sex determining region Y)-box 17; endonuclease-mediated mutation 1, Masami Kanai-Azuma
• MGI ID: MGI:8210927
• Synonyms: Sox17^deltadr
• Gene: Sox17 Location: Chr1:4561154-4567577 bp, - strand Genetic Position: Chr1, 1.65 cM
• Alliance: Sox17^em1Isct page

Mutation origin

• Strain of Origin: C57BL/6JJcl

Mutation description

• Allele Type: Endonuclease-mediated (Modified isoform(s), Modified regulatory region)
• Mutations: Intergenic deletion, Intragenic deletion
• Sox17^em1Isct involves 2 genes/genome features (Rr270, Rr695559) View all
• Mutation details:

  Two conserved regulatory regions upstream of different alternative TSSs (Rr695559) were targeted using sgRNAs (equivalent to TACCGTCCCAAGAGAACCTGAGG, TCCATGGAGCAGGAATAAAGAGG and GACCCGCCAGCAGTGTGAGTGGG) with CRISPR/Cas9 technology, resulting in a 1325 bp deletion of the sequences and most of the non-coding (5' UTR) first exon (GRCm39:chr1:4566594-4567918). (J:361959)

Expression

In Mice Carrying this Mutation:

19 assay results

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Sox17 Mutation: 29 strains or lines available

References

• Original: J:361959 Zeng S, et al., Identification of Gallbladder-Specific Distal Regulatory Sequence of Murine Sox17. Genes Cells. 2025 Jan;30(1):e13186
• All: 1 reference(s)