About   Help   FAQ
Zfp322aem1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Zfp322aem1(IMPC)J
Name: zinc finger protein 322A; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:8210910
Gene: Zfp322a  Location: Chr13:23537273-23553378 bp, - strand  Genetic Position: Chr13, 9.55 cM
Alliance: Zfp322aem1(IMPC)J page
IMPC: Zfp322a gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences: TGATCTAAGTTCTCACGCAT and TTCTATGGTTCTCTCCTAAG. This resulted in a 512 bp deletion of Chr13:23,356,351-23,356,862 (GRCm38/mm10) that removes exon ENSMUSE00000394779. (J:188991)
Inheritance:    Not Specified
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Zfp322a Mutation:  22 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
05/05/2026
MGI 6.24
The Jackson Laboratory