About   Help   FAQ
Zfp606em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Zfp606em1(IMPC)J
Name: zinc finger protein 606; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:8206718
Gene: Zfp606  Location: Chr7:12212220-12230162 bp, + strand  Genetic Position: Chr7, 7.52 cM, cytoband A2
Alliance: Zfp606em1(IMPC)J page
IMPC: Zfp606 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences: ATGTAAAGGACACACTAGAA and AAGTATGTTGTATCTCTGAG. This resulted in a 317 bp deletion of Chr7:12,489,454-12,489,770 (GRCm38/mm10) that removes exon ENSMUSE00001401552. (J:188991)
Inheritance:    Not Specified
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Zfp606 Mutation:  36 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/20/2026
MGI 6.24
The Jackson Laboratory