About   Help   FAQ
Zfp667em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Zfp667em1(IMPC)J
Name: zinc finger protein 667; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:8203454
Gene: Zfp667  Location: Chr7:6289578-6310882 bp, + strand  Genetic Position: Chr7, 3.64 cM
Alliance: Zfp667em1(IMPC)J page
IMPC: Zfp667 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences: CAGGCGACATATCATGACAG and AAACCTTACCAACTGAGACA. This resulted in a 255 bp deletion of Chr7:6,290,437-6,290,691 (GRCm38/mm10) that removes exon ENSMUSE00001300926. (J:188991)
Inheritance:    Not Specified
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Zfp667 Mutation:  30 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
05/05/2026
MGI 6.24
The Jackson Laboratory