About   Help   FAQ
Zkscan6em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Zkscan6em1(IMPC)J
Name: zinc finger with KRAB and SCAN domains 6; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:8190878
Gene: Zkscan6  Location: Chr11:65698001-65720065 bp, + strand  Genetic Position: Chr11, 40.53 cM
Alliance: Zkscan6em1(IMPC)J page
IMPC: Zkscan6 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences: ATTAAATTCAGGGTAAACTG and CGTCATTTCCACACTTTCCA. This resulted in a 568 bp deletion of Chr11:65,815,665-65,816,232 (GRCm38/mm10) that removes exon ENSMUSE00000112310. (J:188991)
Inheritance:    Not Specified
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Zkscan6 Mutation:  24 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/28/2026
MGI 6.24
The Jackson Laboratory