Rr695522^em1Vmc
Endonuclease-mediated Allele Detail

Summary

• Symbol: Rr695522^em1Vmc
• Name: regulatory region 695522; endonuclease-mediated mutation 1, Vincent M Christoffels
• MGI ID: MGI:8186509
• Synonyms: Tbx5^RE(int)KO
• Gene: Rr695522 Location: unknown Genetic Position: Chr5, Syntenic
• Alliance: Rr695522^em1Vmc page

Mutation origin

• Strain of Origin: FVB/NRj

Mutation description

• Allele Type: Endonuclease-mediated (Modified regulatory region)
• Mutation: Intragenic deletion
• Mutation details: The cardiac Tbx5 silencer, located in the last intron, was targeted using sgRNAs (equivalent to GGGAAATCGCCTTACCTTTC and GGACTGTTGGGTCACCTTGT) with CRISPR/Cas9 technology, resulting in a 6.136 kb deletion (GRCm39:chr5:120012078-120018213). (J:360861)

Expression

In Mice Carrying this Mutation:	1 RNA-Seq or microarray experiment(s)
In Structures Affected by this Mutation:	1 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Rr695522 Mutation: 0 strains or lines available

References

• Original: J:360861 Bosada FM, et al., An atrial fibrillation-associated regulatory region modulates cardiac Tbx5 levels and arrhythmia susceptibility. Elife. 2023 Jan 30;12
• All: 1 reference(s)