About   Help   FAQ
Kremen1em1(icre)Cai
Endonuclease-mediated Allele Detail
Summary
Symbol: Kremen1em1(icre)Cai
Name: kringle containing transmembrane protein 1; endonuclease-mediated mutation 1, Huaibin Cai
MGI ID: MGI:8186449
Synonyms: Kremen12A-Cre
Gene: Kremen1  Location: Chr11:5141552-5211558 bp, - strand  Genetic Position: Chr11, 3.36 cM, cytoband A1
Alliance: Kremen1em1(icre)Cai page
Mutation
origin
Strain of Origin:  C57BL/6J
Mutation
description
Allele Type:    Endonuclease-mediated (Recombinase)
Mutation:    Insertion
 
Kremen1em1(icre)Cai expression driven by 1 gene
 
Mutation detailsA sgRNAs (GTGGGCTTCAGTCACTCACGAGG and TGGGCTTCAGTCACTCACGAGGG) were used to target exon 9, immediately after the stop codon, of the kringle containing transmembrane protein 1 (Kremen1) gene for insertion of a 2A oligopeptide (2A) self-cleaving peptide, to mediate ribosomal skipping, fused to a codon-improved Cre recombinase sequence (icre). (J:101977, J:363792)
Recombinase
activity
Activity:
 Tissue activity of this recombinase allele
Driver: Kremen1 (mouse)
Summary of all recombinase alleles driven by Kremen1.
 

Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Kremen1 Mutation:  34 strains or lines available
References
Original:  J:363792 Dong J, et al., Molecularly distinct striatonigral neuron subtypes differentially regulate locomotion. Nat Commun. 2025 Mar 19;16(1):2710
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/24/2026
MGI 6.24
The Jackson Laboratory