About   Help   FAQ
Nacaem1Fsl
Endonuclease-mediated Allele Detail
Summary
Symbol: Nacaem1Fsl
Name: nascent polypeptide-associated complex alpha polypeptide; endonuclease-mediated mutation 1, Frank Lee
MGI ID: MGI:8175505
Synonyms: Naca(AA)
Gene: Naca  Location: Chr10:127871444-127884506 bp, + strand  Genetic Position: Chr10, 76.39 cM, cytoband D2-D3
Alliance: Nacaem1Fsl page
Mutation
origin
Strain of Origin:  C57BL/6J
Mutation
description
Allele Type:    Endonuclease-mediated (Not Applicable)
Mutation:    Nucleotide substitutions
 
Mutation detailsUsing CRISPR/Cas9 endonuclease-mediated genome editing, two guide RNAs (TAGGAGTCTTGTTC CTCGAGCTC and AAACGAGCTCGAGGAACAAGACT) were used to introduce two (L38A/E39A) amino acid substitutions in the nascent polypeptide-associated complex alpha polypeptide (Naca) gene. (J:363102)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Naca Mutation:  73 strains or lines available
References
Original:  J:363102 Song D, et al., The ribosomal chaperone NACA recruits PHD2 to cotranslationally modify HIF-alpha. EMBO J. 2022 Nov 17;41(22):e112059
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
12/30/2025
MGI 6.24
The Jackson Laboratory