Epas1^em1Fsl
Endonuclease-mediated Allele Detail

Summary

• Symbol: Epas1^em1Fsl
• Name: endothelial PAS domain protein 1; endonuclease-mediated mutation 1, Frank Lee
• MGI ID: MGI:8174634
• Synonyms: Hif2a^H194R
• Gene: Epas1 Location: Chr17:87061292-87140838 bp, + strand Genetic Position: Chr17, 56.9 cM
• Alliance: Epas1^em1Fsl page

Mutation origin

• Strain of Origin: C57BL/6J

Mutation description

• Allele Type: Endonuclease-mediated (Humanized sequence)
• Mutation: Single point mutation
• Mutation details: Using CRISPR technology, two guide RNAs (TAGGCCCCAGGTCCTGCACTGCAC and AAACGTGCAGTGCAGGACCTGGGG) were used to introduce A to G point mutation in exon 6 of the endothelial PAS domain protein 1 (Epas1) gene (J:364870)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Epas1 Mutation: 66 strains or lines available

References

• Original: J:364870 Jorgensen K, et al., High-Altitude Andean H194R HIF2A Allele Is a Hypomorphic Allele. Mol Biol Evol. 2023 Jul 5;40(7)
• All: 1 reference(s)