Rr612^em1Aben
Endonuclease-mediated Allele Detail

Summary

• Symbol: Rr612^em1Aben
• Name: regulatory region 612; endonuclease-mediated mutation 1, Albert Bendelac
• MGI ID: MGI:8164018
• Synonyms: Gata3 +674/762 delta
• Gene: Rr612 Location: Chr2:9120896-9208642 bp Genetic Position: Chr2, Syntenic
• Alliance: Rr612^em1Aben page

Mutation origin

• Strain of Origin: C57BL/6J

Mutation description

• Allele Type: Endonuclease-mediated (Modified regulatory region)
• Mutation: Intragenic deletion
• Mutation details:

  Using CRISPR/Cas9 endonuclease-mediated genome editing. Guide crRNAs [CACAAGTTATAATGAGCGTG and TACTACACACGTGTAAGTAC] were used to target a distal regulatory region Rr612 of the GATA binding protein 3 (Gata3) gene on chromosome 2 and remove an 88 kb region spanning from +674 kb to +762 kb. (J:101977, J:309550)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Rr612 Mutation: 1 strain or line available

References

• Original: J:309550 Kasal DN, et al., A Gata3 enhancer necessary for ILC2 development and function. Proc Natl Acad Sci U S A. 2021 Aug 10;118(32):e2106311118
• All: 2 reference(s)