About   Help   FAQ
Tafa5em1Yw
Endonuclease-mediated Allele Detail
Summary
Symbol: Tafa5em1Yw
Name: TAFA chemokine like family member 5; endonuclease-mediated mutation 1, Ying Wang
MGI ID: MGI:8161954
Synonyms: Fam19a5-
Gene: Tafa5  Location: Chr15:87428500-87643565 bp, + strand  Genetic Position: Chr15, 42.1 cM
Alliance: Tafa5em1Yw page
Mutation
origin
Strain of Origin:  C57BL/6J
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutations:    Intragenic deletion, Nucleotide substitutions
 
Mutation details

CRISPR/Cas9 technology generated a 32 bp deletion (CCAGCCACGGAGGACGATCGCCCGGCAGACAG) and mutated four bases (CACG) in exon 2. Quantitative real-time PCR indicated severely reduced mRNA level in the brain and immunofluorescence showed absence of expression in the brain (J:360963)

Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 3 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Tafa5 Mutation:  13 strains or lines available
References
Original:  J:360963 Huang S, et al., FAM19A5/TAFA5, a novel neurokine, plays a crucial role in depressive-like and spatial memory-related behaviors in mice. Mol Psychiatry. 2021 Jun;26(6):2363-2379
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
07/14/2026
MGI 6.24
The Jackson Laboratory