Trgc4^em1Dmuc
Endonuclease-mediated Allele Detail

Summary

• Symbol: Trgc4^em1Dmuc
• Name: T cell receptor gamma, constant 4; endonuclease-mediated mutation 1, Daniel Mucida
• MGI ID: MGI:8161692
• Gene: Trgc4 Location: Chr13:19528728-19536513 bp, + strand Genetic Position: Chr13, 6.89 cM
• Alliance: Trgc4^em1Dmuc page

Mutation origin

• Strain of Origin: C57BL/6J

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: sgRNA (UUCUGGAAUCCCAGGAAGGAAAC) and cas9 protein were injected into C57BL/6J embryos to create a 4 bp deletion (CCCA) in exon 1 of the mouse Trgc4 gene. (J:101977)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Trgc4 Mutation: 10 strains or lines available

References

• Original: J:101977 The Jackson Laboratory, Information obtained from The Jackson Laboratory, Bar Harbor, ME. Unpublished. 2005-2017
• All: 1 reference(s)