About   Help   FAQ
I830077J02Rikem1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: I830077J02Rikem1(IMPC)J
Name: RIKEN cDNA I830077J02 gene; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:8161072
Gene: I830077J02Rik  Location: Chr3:105831674-105839980 bp, - strand  Genetic Position: Chr3, 46.45 cM
Alliance: I830077J02Rikem1(IMPC)J page
IMPC: I830077J02Rik gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences: GAGATGTCAGTCATACCTGG and CATCACTGCAACTCCATAGA. This resulted in a 4,544 bp deletion of Chr3:105,924,331-105,928,874(GRCm38/mm10) that removes exon ENSMUSE00001218629 through ENSMUSE00000636872. (J:188991)
Inheritance:    Not Specified
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any I830077J02Rik Mutation:  11 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/28/2026
MGI 6.24
The Jackson Laboratory