About   Help   FAQ
Ighaem1Hoet
Endonuclease-mediated Allele Detail
Summary
Symbol: Ighaem1Hoet
Name: immunoglobulin heavy constant alpha; endonuclease-mediated mutation 1, Hans C Oettgen
MGI ID: MGI:8158329
Synonyms: IgA-
Gene: Igha  Location: Chr12:113219824-113223856 bp, - strand  Genetic Position: Chr12, 62.09 cM
Alliance: Ighaem1Hoet page
Mutation
origin
Strain of Origin:  BALB/cJ
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsA single guide RNA (GGCAGGTGGGAAGTTTACGGTGG) was used to introduce a 1bp deletion in exon 1 of the immunoglobulin heavy constant alpha (Igha) gene on chromosome 12. (J:101977, J:362226)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Igha Mutation:  22 strains or lines available
References
Original:  J:362226 El Ansari YS, et al., T follicular helper cell expansion and hyperimmunoglobulinemia with spontaneous IgE production to dietary antigens in IgA-deficient mice. Mucosal Immunol. 2025 Jan 15;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/24/2026
MGI 6.24
The Jackson Laboratory