Slc6a20b^em1Mbp
Endonuclease-mediated Allele Detail

Summary

• Symbol: Slc6a20b^em1Mbp
• Name: solute carrier family 6 (neurotransmitter transporter), member 20B; endonuclease-mediated mutation 1, Mouse Biology Program, UC Davis
• MGI ID: MGI:7867584
• Gene: Slc6a20b Location: Chr9:123422888-123461603 bp, - strand Genetic Position: Chr9, 74.19 cM, cytoband F4
• Alliance: Slc6a20b^em1Mbp page

Mutation origin

• Strain of Origin: C57BL/6N-Tmprss2^{em1(TMPRSS2)Mbp} Ace2^em1(ACE2)Mbp/Mmucd

Mutation description

• Allele Type: Endonuclease-mediated (Not Specified)
• Mutations: Not Specified, Single point mutation
• Mutation details: CRISPR RNP using guide CCTCGCTGCCTCAACCTCAC was used to assist with homology directed repair (HDR) using an ssODN repair template with the following single G to T SNP edit: AACCTCACAG(G/T)TGGCCAGTTT in the mouse 5UTR. Slc6a20b_5UTRG to T was created in the mouse to model the human 5'UTR variant caused by rs2271616. (J:94077)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Slc6a20b Mutation: 35 strains or lines available

References

• Original: J:94077 Mutant Mouse Regional Resource Centers, Information obtained from the Mutant Mouse Regional Resource Centers (MMRRC). Unpublished. 2004-2015
• All: 1 reference(s)