Rr592em1Rnis
Endonuclease-mediated Allele Detail
|
|
| Symbol: |
Rr592em1Rnis |
| Name: |
regulatory region 592; endonuclease-mediated mutation 1, Riko Nishimura |
| MGI ID: |
MGI:7852298 |
| Synonyms: |
E308delta |
| Gene: |
Rr592 Location: Chr11:112363876-112364806 bp Genetic Position: Chr11, Syntenic
|
| Alliance: |
Rr592em1Rnis page
|
|
|
|
| Allele Type: |
|
Endonuclease-mediated (Modified regulatory region) |
| Mutation: |
|
Intergenic deletion
|
| |
|
Mutation details: The chondrocyte-specific Sox9 enhancer, located upstream, was targeted using sgRNAs (equivalent to TGCTAGGAGACTCGTCAATGGGG, CCTTCTCCAAGGTGGATTTCATG, CCTTTGGATTCCCTACCCACATG and CCACATGTGATAGATTAGACATA) with CRISPR/Cas9 technology, resulting in a deletion.
(J:358821)
|
|
|
| Mouse strains and cell lines
available from the International Mouse Strain Resource
(IMSR) |
| Carrying this Mutation: |
Mouse Strains: 0 strains available
Cell Lines: 0 lines available
|
| Carrying any Rr592 Mutation: |
0 strains or lines available
|
|
| Original: |
J:358821 Ichiyama-Kobayashi S, et al., Chromatin profiling identifies chondrocyte-specific Sox9 enhancers important for skeletal development. JCI Insight. 2024 Jun 10;9(11) |
| All: |
1 reference(s) |
|