About   Help   FAQ
Rr592em1Rnis
Endonuclease-mediated Allele Detail
Summary
Symbol: Rr592em1Rnis
Name: regulatory region 592; endonuclease-mediated mutation 1, Riko Nishimura
MGI ID: MGI:7852298
Synonyms: E308delta
Gene: Rr592  Location: unknown  Genetic Position: Chr11, Syntenic
Alliance: Rr592em1Rnis page
Mutation
origin
Strain of Origin:  C57BL/6J
Mutation
description
Allele Type:    Endonuclease-mediated (Modified regulatory region)
Mutation:    Intergenic deletion
 
Mutation detailsThe chondrocyte-specific Sox9 enhancer, located upstream, was targeted using sgRNAs (equivalent to TGCTAGGAGACTCGTCAATGGGG, CCTTCTCCAAGGTGGATTTCATG, CCTTTGGATTCCCTACCCACATG and CCACATGTGATAGATTAGACATA) with CRISPR/Cas9 technology, resulting in a deletion. (J:358821)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Rr592 Mutation:  0 strains or lines available
References
Original:  J:358821 Ichiyama-Kobayashi S, et al., Chromatin profiling identifies chondrocyte-specific Sox9 enhancers important for skeletal development. JCI Insight. 2024 Jun 10;9(11)
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/24/2026
MGI 6.24
The Jackson Laboratory