Tcf7l2^em1Rudl
Endonuclease-mediated Allele Detail

Summary

• Symbol: Tcf7l2^em1Rudl
• Name: transcription factor 7 like 2, T cell specific, HMG box; endonuclease-mediated mutation 1, Christiane Ruedl
• MGI ID: MGI:7852267
• Gene: Tcf7l2 Location: Chr19:55730252-55922086 bp, + strand Genetic Position: Chr19, 51.59 cM
• Alliance: Tcf7l2^em1Rudl page

Mutation origin

• Germline Transmission: Earliest citation of germline transmission: J:101977
• Parent Cell Line: W4 (ES Cell)
• Strain of Origin: 129S6/SvEvTac

Mutation description

• Allele Type: Endonuclease-mediated (Inducible)
• Inducer: doxycycline/tetracycline
• Mutation: Insertion
• Mutation details: Using CRISPR-cas9 technology, a tetO was inserted into intron 3 of the transcription factor 7 like 2, T cell specific, HMG box (Tcf7l2) gene (based on Tcf7l2 ENSMUST00000111656.8). A sgRNA (GTGCGTCTTGGGCTTTCCCC) designed to target the Tcf7l2 locus was used to insert this TRE)mod( sequence (from pTREtight vector) via transient transfection into 129S6/SvEvTac-derived W4 embryonic stem (ES) cells. Endogenous Tcf7l2 mRNA expression and splicing were unaffected. (J:101977)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Tcf7l2 Mutation: 58 strains or lines available

References

• Original: J:101977 The Jackson Laboratory, Information obtained from The Jackson Laboratory, Bar Harbor, ME. Unpublished. 2005-2017
• All: 1 reference(s)