Gt(ROSA)26Sorem1(CAG-rtetR,-Zfp354a*)Rudl
Endonuclease-mediated Allele Detail
|
|
| Symbol: |
Gt(ROSA)26Sorem1(CAG-rtetR,-Zfp354a*)Rudl |
| Name: |
gene trap ROSA 26, Philippe Soriano; endonuclease-mediated mutation 1, Christiane Ruedl |
| MGI ID: |
MGI:7852266 |
| Gene: |
Gt(ROSA)26Sor Location: Chr6:113044389-113054205 bp, - strand Genetic Position: Chr6, 52.73 cM
|
| Alliance: |
Gt(ROSA)26Sorem1(CAG-rtetR,-Zfp354a*)Rudl page
|
|
| Germline Transmission: |
Earliest citation of germline transmission:
J:101977
|
| Parent Cell Line: |
W4 (ES Cell)
|
| Strain of Origin: |
129S6/SvEvTac
|
|
| Allele Type: |
|
Endonuclease-mediated (Inserted expressed sequence, Transactivator) |
| Mutation: |
|
Insertion
|
| |
|
Mutation details: By CRISPR-cas9 technology, (from 5' to 3') a CMV-IE enhancer/chicken beta-actin/rabbit beta-globin hybrid promoter (CAG), a reverse tetracycline repressor (rTetR), a nuclear localization sequence, and the transcriptional-repressing KRAB domain from zinc finger protein 354A (Zfp354a) gene followed by a polyadenylation sequence was inserted into Gt(ROSA)26Sor locus. rTetR was cloned from rtTA lacking the VP16 domain. The minimal KRAB domain spans amino acids 12 to 53 of the Zfp354a gene. A sgRNA (GACTGGAGTTGCAGATCACG) designed to target the Gt(ROSA)26Sor locus (based on Gt(ROSA)26Sor ENSMUST00000332437.1) was used to insert this Rosa26-rTetR-KRAB cassette via transient transfection into 129S6/SvEvTac-derived W4 embryonic stem (ES) cells.
(J:101977)
|
|
|
|
|
| Original: |
J:101977 The Jackson Laboratory, Information obtained from The Jackson Laboratory, Bar Harbor, ME. Unpublished. 2005-2017; |
| All: |
1 reference(s) |
|