Gt(ROSA)26Sor^{em1(CAG-rtetR,-Zfp354a*)Rudl}
Endonuclease-mediated Allele Detail

Summary

• Symbol: Gt(ROSA)26Sor^{em1(CAG-rtetR,-Zfp354a*)Rudl}
• Name: gene trap ROSA 26, Philippe Soriano; endonuclease-mediated mutation 1, Christiane Ruedl
• MGI ID: MGI:7852266
• Gene: Gt(ROSA)26Sor Location: Chr6:113044389-113054205 bp, - strand Genetic Position: Chr6, 52.73 cM
• Alliance: Gt(ROSA)26Sor^{em1(CAG-rtetR,-Zfp354a*)Rudl} page

Mutation origin

• Germline Transmission: Earliest citation of germline transmission: J:101977
• Parent Cell Line: W4 (ES Cell)
• Strain of Origin: 129S6/SvEvTac

Mutation description

• Allele Type: Endonuclease-mediated (Inserted expressed sequence, Transactivator)
• Mutation: Insertion
• Mutation details: By CRISPR-cas9 technology, (from 5' to 3') a CMV-IE enhancer/chicken beta-actin/rabbit beta-globin hybrid promoter (CAG), a reverse tetracycline repressor (rTetR), a nuclear localization sequence, and the transcriptional-repressing KRAB domain from zinc finger protein 354A (Zfp354a) gene followed by a polyadenylation sequence was inserted into Gt(ROSA)26Sor locus. rTetR was cloned from rtTA lacking the VP16 domain. The minimal KRAB domain spans amino acids 12 to 53 of the Zfp354a gene. A sgRNA (GACTGGAGTTGCAGATCACG) designed to target the Gt(ROSA)26Sor locus (based on Gt(ROSA)26Sor ENSMUST00000332437.1) was used to insert this Rosa26-rTetR-KRAB cassette via transient transfection into 129S6/SvEvTac-derived W4 embryonic stem (ES) cells. (J:101977)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Gt(ROSA)26Sor Mutation: 1095 strains or lines available

References

• Original: J:101977 The Jackson Laboratory, Information obtained from The Jackson Laboratory, Bar Harbor, ME. Unpublished. 2005-2017
• All: 1 reference(s)