About   Help   FAQ
Gt(ROSA)26Sorem1(CAG-rtetR,-Zfp354a*)Rudl
Endonuclease-mediated Allele Detail
Summary
Symbol: Gt(ROSA)26Sorem1(CAG-rtetR,-Zfp354a*)Rudl
Name: gene trap ROSA 26, Philippe Soriano; endonuclease-mediated mutation 1, Christiane Ruedl
MGI ID: MGI:7852266
Gene: Gt(ROSA)26Sor  Location: Chr6:113044389-113054205 bp, - strand  Genetic Position: Chr6, 52.73 cM
Alliance: Gt(ROSA)26Sorem1(CAG-rtetR,-Zfp354a*)Rudl page
Mutation
origin
Germline Transmission:  Earliest citation of germline transmission: J:101977
Parent Cell Line:  W4 (ES Cell)
Strain of Origin:  129S6/SvEvTac
Mutation
description
Allele Type:    Endonuclease-mediated (Inserted expressed sequence, Transactivator)
Mutation:    Insertion
 
Mutation detailsBy CRISPR-cas9 technology, (from 5' to 3') a CMV-IE enhancer/chicken beta-actin/rabbit beta-globin hybrid promoter (CAG), a reverse tetracycline repressor (rTetR), a nuclear localization sequence, and the transcriptional-repressing KRAB domain from zinc finger protein 354A (Zfp354a) gene followed by a polyadenylation sequence was inserted into Gt(ROSA)26Sor locus. rTetR was cloned from rtTA lacking the VP16 domain. The minimal KRAB domain spans amino acids 12 to 53 of the Zfp354a gene. A sgRNA (GACTGGAGTTGCAGATCACG) designed to target the Gt(ROSA)26Sor locus (based on Gt(ROSA)26Sor ENSMUST00000332437.1) was used to insert this Rosa26-rTetR-KRAB cassette via transient transfection into 129S6/SvEvTac-derived W4 embryonic stem (ES) cells. (J:101977)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Gt(ROSA)26Sor Mutation:  1096 strains or lines available
References
Original:  J:101977 The Jackson Laboratory, Information obtained from The Jackson Laboratory, Bar Harbor, ME. Unpublished. 2005-2017;
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/24/2026
MGI 6.24
The Jackson Laboratory