Adgre5^em2Cys
Endonuclease-mediated Allele Detail

Summary

• Symbol: Adgre5^em2Cys
• Name: adhesion G protein-coupled receptor E5; endonuclease-mediated mutation 1, Jason G Cyster
• MGI ID: MGI:7840408
• Gene: Adgre5 Location: Chr8:84449874-84467812 bp, - strand Genetic Position: Chr8, 40.22 cM
• Alliance: Adgre5^em2Cys page

Mutation origin

• Strain of Origin: C57BL/6J

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: CRISPR-cas9 mediated recombination using guide RNAs (GTAAAATGCACACCACTGCA and GAGAGTGAGAATACATGTCA) created a 977 bp deletion including all of exons 2 and 3. This allele is generated as Adgre5^em1Cys allele and studied in parallel. (J:101977, J:324874)

Expression

In Mice Carrying this Mutation:

1 RNA-Seq or microarray experiment(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Adgre5 Mutation: 66 strains or lines available

References

• Original: J:324874 Liu D, et al., CD97 promotes spleen dendritic cell homeostasis through the mechanosensing of red blood cells. Science. 2022 Feb 11;375(6581):eabi5965
• All: 2 reference(s)