About   Help   FAQ
Poleem1Ewht
Endonuclease-mediated Allele Detail
Summary
Symbol: Poleem1Ewht
Name: polymerase (DNA directed), epsilon; endonuclease-mediated mutation 1, Eileen White
MGI ID: MGI:7797729
Synonyms: Pole D272A E274A
Gene: Pole  Location: Chr5:110434185-110485319 bp, + strand  Genetic Position: Chr5, 53.45 cM, cytoband E3-E5
Alliance: Poleem1Ewht page
Mutation
origin
Strain of Origin:  C57BL/6J
Mutation
description
Allele Type:    Endonuclease-mediated (Not Applicable)
Mutation:    Nucleotide substitutions
 
Mutation detailsUsing an sgRNA (equivalent to AGGGAATTTGAGAGGCAGTT) and an ssODN template with CRISPR/Cas9 technology, codon 275 was changed from aspartic acid (GAC) to alanine (GCC) (g.GRCm39:chr5:110442397A>C, p.D275A) and codon 277 was changed from glutamic acid (GAG) to alanine (GCG) (g.GRCm39:chr5:110442403A>C, p.E277A). (J:364251)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Pole Mutation:  103 strains or lines available
References
Original:  J:364251 Sawant A, et al., Immune Checkpoint Blockade Delays Cancer Development and Extends Survival in DNA Polymerase Mutator Syndromes. Cancer Res. 2025 Mar 14;85(6):1130-1144
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/24/2026
MGI 6.24
The Jackson Laboratory