About   Help   FAQ
Poleem1Ewht
Endonuclease-mediated Allele Detail
Summary
Symbol: Poleem1Ewht
Name: polymerase (DNA directed), epsilon; endonuclease-mediated mutation 1, Eileen White
MGI ID: MGI:7797729
Synonyms: Pole D272A E274A
Gene: Pole  Location: Chr5:110434185-110485319 bp, + strand  Genetic Position: Chr5, 53.45 cM, cytoband E3-E5
Alliance: Poleem1Ewht page
Mutation
origin
Strain of Origin:  C57BL/6J
Mutation
description
Allele Type:    Endonuclease-mediated (Not Applicable)
Mutation:    Nucleotide substitutions
 
Mutation detailsUsing CRISPR technology, a sgRNA (AGGGAATTTGAGAGGCAGTT) was designed to target the Pole gene to introduce 2 mutations: a GAC to GCC resulting in an aspartic acid to alanine mutation at amino acid 272 (D272A) and a GAG to GCG mutation resulting in a glutamic acid to alanine mutation at amino acid 274 (E274A). (J:364251)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Pole Mutation:  102 strains or lines available
References
Original:  J:364251 Sawant A, et al., Immune Checkpoint Blockade Delays Cancer Development and Extends Survival in DNA Polymerase Mutator Syndromes. Cancer Res. 2025 Mar 14;85(6):1130-1144
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/25/2025
MGI 6.24
The Jackson Laboratory