Pura^em1Lutzy
Endonuclease-mediated Allele Detail

Summary

• Symbol: Pura^em1Lutzy
• Name: purine rich element binding protein A; endonuclease-mediated mutation 1, Cathy Lutz
• MGI ID: MGI:7790925
• Gene: Pura Location: Chr18:36414150-36425588 bp, + strand Genetic Position: Chr18, 19.46 cM, cytoband B3
• Alliance: Pura^em1Lutzy page

Mutation origin

• Strain of Origin: C57BL/6J

Mutation description

• Allele Type: Endonuclease-mediated (Conditional ready)
• Mutation: Insertion
• Mutation details: Using CRISPR/Cas9 endonuclease-mediated genome editing, the guide RNAs (TGCGCCCGCCCGACTGTGCG, GAAGAGAAACTGTCAGTTGG) were selected to excise and replace murine exon 2 of the purine rich element binding protein A (Pura) gene on chromosome 18, with a loxP-flanked wildtype exon 2 cassette. (J:94077)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Pura Mutation: 29 strains or lines available

References

• Original: J:94077 Mutant Mouse Regional Resource Centers, Information obtained from the Mutant Mouse Regional Resource Centers (MMRRC). Unpublished. 2004-2015
• All: 1 reference(s)