About   Help   FAQ
Puraem1Lutzy
Endonuclease-mediated Allele Detail
Summary
Symbol: Puraem1Lutzy
Name: purine rich element binding protein A; endonuclease-mediated mutation 1, Cathy Lutz
MGI ID: MGI:7790925
Gene: Pura  Location: Chr18:36414150-36425588 bp, + strand  Genetic Position: Chr18, 19.46 cM, cytoband B3
Alliance: Puraem1Lutzy page
Mutation
origin
Strain of Origin:  C57BL/6J
Mutation
description
Allele Type:    Endonuclease-mediated (Conditional ready)
Mutation:    Insertion
 
Mutation details

Using CRISPR/Cas9 endonuclease-mediated genome editing, the guide RNAs (TGCGCCCGCCCGACTGTGCG, GAAGAGAAACTGTCAGTTGG) were selected to excise and replace murine exon 2 of the purine rich element binding protein A (Pura) gene on chromosome 18, with a loxP-flanked wildtype exon 2 cassette. (J:94077)

Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Pura Mutation:  29 strains or lines available
References
Original:  J:94077 Mutant Mouse Regional Resource Centers, Information obtained from the Mutant Mouse Regional Resource Centers (MMRRC). Unpublished. 2004-2015;
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
07/14/2026
MGI 6.24
The Jackson Laboratory