Zfp169^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Zfp169^em1(IMPC)J
• Name: zinc finger protein 169; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:7787112
• Gene: Zfp169 Location: Chr13:48641123-48666927 bp, - strand Genetic Position: Chr13, 24.81 cM
• Alliance: Zfp169^em1(IMPC)J page
• IMPC: Zfp169 gene page

Mutation origin

• Strain of Origin: Not Applicable
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory using Cas9 and guides with spacer sequences AAGCAAAGGCACGCCCACAC and GAGGGCTCTAATTCTGTCCT that targeted exon(s) ENSMUSE00000335552.9 ENSMUSE00000682813.2 ENSMUSE00000957831.2 ENSMUSE00001688018.1. This resulted in deletion(s) of 1875 bp (location: Chr13:48642991-48644865; GRCm39). This description was generated automatically. Additional molecular information including FASTA sequence support for this allele can be found here: (IMPC Gene page) and viewed in a genome context here: (IMPC Genome Browser). (J:384794)

• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Zfp169 Mutation: 25 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 2 reference(s)