About   Help   FAQ
Rr504em4Takas
Endonuclease-mediated Allele Detail
Summary
Symbol: Rr504em4Takas
Name: regulatory region 504; endonuclease-mediated mutation 4, Shuji Takada
MGI ID: MGI:7787033
Synonyms: SOX9 BSsub/SRY BSsub
Gene: Rr504  Location: Chr11:112108104-112108661 bp  Genetic Position: Chr11, Syntenic
Alliance: Rr504em4Takas page
Mutation
origin
Strain of Origin:  C57BL/6J
Mutation
description
Allele Type:    Endonuclease-mediated (Modified regulatory region)
Mutation:    Nucleotide substitutions
 
Mutation detailsThe SRY-binding site TCTAAACAA (GRCm39:chr11:112108459-112108467) within the embryonic Sox9 testis enhancer was targeted using an sgRNA (equivalent to CTCAGCTGTTTGTTTAGAAGTGG) and an ssODN template with CRISPR/Cas9 technology, resulting in it being replaced with GGGGGGGGAA. This allele was created in zygotes carrying the Rr504em2Takas allele on the paternal chromosome and embryos carrying both alleles on the same chromosome were selected. (J:334329)
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 2 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Rr504 Mutation:  0 strains or lines available
References
Original:  J:334329 Ogawa Y, et al., SOX9 and SRY binding sites on mouse mXYSRa/Enh13 enhancer redundantly regulate Sox9 expression to varying degrees. Hum Mol Genet. 2023 Jan 1;32(1):55-64
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
07/29/2025
MGI 6.24
The Jackson Laboratory