Rr504em4Takas
Endonuclease-mediated Allele Detail
|
|
| Symbol: |
Rr504em4Takas |
| Name: |
regulatory region 504; endonuclease-mediated mutation 4, Shuji Takada |
| MGI ID: |
MGI:7787033 |
| Synonyms: |
SOX9 BSsub/SRY BSsub |
| Gene: |
Rr504 Location: Chr11:112108104-112108661 bp Genetic Position: Chr11, Syntenic
|
| Alliance: |
Rr504em4Takas page
|
|
|
|
| Allele Type: |
|
Endonuclease-mediated (Modified regulatory region) |
| Mutation: |
|
Nucleotide substitutions
|
| |
|
Mutation details: The SRY-binding site TCTAAACAA (GRCm39:chr11:112108459-112108467) within the embryonic Sox9 testis enhancer was targeted using an sgRNA (equivalent to CTCAGCTGTTTGTTTAGAAGTGG) and an ssODN template with CRISPR/Cas9 technology, resulting in it being replaced with GGGGGGGGAA. This allele was created in zygotes carrying the Rr504em2Takas allele on the paternal chromosome and embryos carrying both alleles on the same chromosome were selected.
(J:334329)
|
|
|
View phenotypes and curated references for all genotypes (concatenated display).
|
|
|
| Mouse strains and cell lines
available from the International Mouse Strain Resource
(IMSR) |
| Carrying this Mutation: |
Mouse Strains: 0 strains available
Cell Lines: 0 lines available
|
| Carrying any Rr504 Mutation: |
0 strains or lines available
|
|
| Original: |
J:334329 Ogawa Y, et al., SOX9 and SRY binding sites on mouse mXYSRa/Enh13 enhancer redundantly regulate Sox9 expression to varying degrees. Hum Mol Genet. 2023 Jan 1;32(1):55-64 |
| All: |
1 reference(s) |
|