Slc52a2^em6Lutzy
Endonuclease-mediated Allele Detail

Summary

• Symbol: Slc52a2^em6Lutzy
• Name: solute carrier protein 52, member 2; endonuclease-mediated mutation 6, Cathy Lutz
• MGI ID: MGI:7786611
• Gene: Slc52a2 Location: Chr15:76423032-76428808 bp, + strand Genetic Position: Chr15, 36.04 cM
• Alliance: Slc52a2^em6Lutzy page

Mutation origin

• Strain of Origin: C57BL/6J

Mutation description

• Allele Type: Endonuclease-mediated (Humanized sequence)
• Mutation: Nucleotide substitutions
• Mutation details: Using CRISPR/Cas9 endonuclease-mediated genome editing, a guide RNA (ATCCTTGGCAGGTCTCTGGC), and a single stranded oligo donor carrying the silent L341L (CTG>CTC) variant and missense L344P (CTG>CCG) mutation, were used to target the solute carrier protein 52, member 2 (Slc52a2) gene. (J:94077)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Slc52a2 Mutation: 23 strains or lines available

References

• Original: J:94077 Mutant Mouse Regional Resource Centers, Information obtained from the Mutant Mouse Regional Resource Centers (MMRRC). Unpublished. 2004-2015
• All: 1 reference(s)