About   Help   FAQ
Slc52a2em2Lutzy
Endonuclease-mediated Allele Detail
Summary
Symbol: Slc52a2em2Lutzy
Name: solute carrier protein 52, member 2; endonuclease-mediated mutation 2, Cathy Lutz
MGI ID: MGI:7786609
Gene: Slc52a2  Location: Chr15:76423032-76428808 bp, + strand  Genetic Position: Chr15, 36.04 cM
Alliance: Slc52a2em2Lutzy page
Mutation
origin
Strain of Origin:  C57BL/6J
Mutation
description
Allele Type:    Endonuclease-mediated (Humanized sequence)
Mutation:    Nucleotide substitutions
 
Mutation detailsUsing CRISPR/Cas9 endonuclease-mediated genome editing. A guide RNA (TGGGCGCCTGGCCTACCACT), and a single stranded oligo donor carrying the missense missense L317P (TTG>CCA) variant, were used to target the solute carrier protein 52, member 2 (Slc52a2) gene. (J:94077)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Slc52a2 Mutation:  23 strains or lines available
References
Original:  J:94077 Mutant Mouse Regional Resource Centers, Information obtained from the Mutant Mouse Regional Resource Centers (MMRRC). Unpublished. 2004-2015;
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/28/2026
MGI 6.24
The Jackson Laboratory