Slc52a2em2Lutzy
Endonuclease-mediated Allele Detail
|
|
| Symbol: |
Slc52a2em2Lutzy |
| Name: |
solute carrier protein 52, member 2; endonuclease-mediated mutation 2, Cathy Lutz |
| MGI ID: |
MGI:7786609 |
| Gene: |
Slc52a2 Location: Chr15:76423032-76428808 bp, + strand Genetic Position: Chr15, 36.04 cM
|
| Alliance: |
Slc52a2em2Lutzy page
|
|
|
|
| Allele Type: |
|
Endonuclease-mediated (Humanized sequence) |
| Mutation: |
|
Nucleotide substitutions
|
| |
|
Mutation details: Using CRISPR/Cas9 endonuclease-mediated genome editing. A guide RNA (TGGGCGCCTGGCCTACCACT), and a single stranded oligo donor carrying the missense missense L317P (TTG>CCA) variant, were used to target the solute carrier protein 52, member 2 (Slc52a2) gene.
(J:94077)
|
|
|
| Mouse strains and cell lines
available from the International Mouse Strain Resource
(IMSR) |
| Carrying this Mutation: |
Mouse Strains: 0 strains available
Cell Lines: 0 lines available
|
| Carrying any Slc52a2 Mutation: |
23 strains or lines available
|
|
| Original: |
J:94077 Mutant Mouse Regional Resource Centers, Information obtained from the Mutant Mouse Regional Resource Centers (MMRRC). Unpublished. 2004-2015; |
| All: |
1 reference(s) |
|