Fam171a2em1(IMPC)Bay
Endonuclease-mediated Allele Detail
|
|
| Symbol: |
Fam171a2em1(IMPC)Bay |
| Name: |
family with sequence similarity 171, member A2; endonuclease-mediated mutation 1, Baylor College of Medicine |
| MGI ID: |
MGI:7785511 |
| Gene: |
Fam171a2 Location: Chr11:102327807-102338508 bp, - strand Genetic Position: Chr11, 66.29 cM
|
| Alliance: |
Fam171a2em1(IMPC)Bay page
|
| IMPC: |
Fam171a2 gene page |
|
| Strain of Origin: |
C57BL/6N
|
| Project Collection: |
IMPC
|
|
| Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
| Mutation: |
|
Intragenic deletion
|
| |
|
Mutation details:
This allele was generated at Baylor College of Medicine using Cas9 and guides with spacer sequences CGCGACCCTCCTCTAGACCG and GGGCTGGTTGGAGCCGCGAT that targeted exon(s) ENSMUSE00000235042.2 ENSMUSE00000235050.2 ENSMUSE00000351692.2 ENSMUSE00000389123.2 ENSMUSE00001915419.1 ENSMUSE00001915434.1. This resulted in deletion(s) of 1419 bp (location: Chr11:102330033-102331451; GRCm39). This description was generated automatically. Additional molecular information including FASTA sequence support for this allele can be found here: (IMPC Gene page) and viewed in a genome context here: (IMPC Genome Browser). (J:384794)
|
| Inheritance: |
|
Not Specified |
|
|
View phenotypes and curated references for all genotypes (concatenated display).
|
|
|
| Original: |
J:265051 MGI and IMPC, MGI Load of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). Database Release. 2018-2023; |
| All: |
3 reference(s) |
|