Hdac8^em1Lutzy
Endonuclease-mediated Allele Detail

Summary

• Symbol: Hdac8^em1Lutzy
• Name: histone deacetylase 8; endonuclease-mediated mutation 1, Cathy Lutz
• MGI ID: MGI:7783542
• Gene: Hdac8 Location: ChrX:101328245-101548965 bp, - strand Genetic Position: ChrX, 45.28 cM, cytoband C3
• Alliance: Hdac8^em1Lutzy page

Mutation origin

• Strain of Origin: C57BL/6J

Mutation description

• Allele Type: Endonuclease-mediated (Humanized sequence)
• Mutation: Nucleotide substitutions
• Mutation details: Using CRISPR/Cas9 endonuclease-mediated genome editing guide RNAs [CGGGACTGTAAATATAAACC; TCGGGACTGTAAATATAAAC] were selected to target exon 1 of the histone deacetylase 8 locus (Hdac8) on Chromosome X. Donor DNAs were created encoding a I19S missense mutation (ATT>AGC) and a silent V17V PAM deletion (GTT>GTG). (J:94077)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Hdac8 Mutation: 11 strains or lines available

References

• Original: J:94077 Mutant Mouse Regional Resource Centers, Information obtained from the Mutant Mouse Regional Resource Centers (MMRRC). Unpublished. 2004-2015
• All: 1 reference(s)