About   Help   FAQ
Hdac8em1Lutzy
Endonuclease-mediated Allele Detail
Summary
Symbol: Hdac8em1Lutzy
Name: histone deacetylase 8; endonuclease-mediated mutation 1, Cathy Lutz
MGI ID: MGI:7783542
Gene: Hdac8  Location: ChrX:101328245-101548965 bp, - strand  Genetic Position: ChrX, 45.28 cM, cytoband C3
Alliance: Hdac8em1Lutzy page
Mutation
origin
Strain of Origin:  C57BL/6J
Mutation
description
Allele Type:    Endonuclease-mediated (Humanized sequence)
Mutation:    Nucleotide substitutions
 
Mutation detailsUsing CRISPR/Cas9 endonuclease-mediated genome editing guide RNAs [CGGGACTGTAAATATAAACC; TCGGGACTGTAAATATAAAC] were selected to target exon 1 of the histone deacetylase 8 locus (Hdac8) on Chromosome X. Donor DNAs were created encoding a I19S missense mutation (ATT>AGC) and a silent V17V PAM deletion (GTT>GTG). (J:94077)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Hdac8 Mutation:  12 strains or lines available
References
Original:  J:94077 Mutant Mouse Regional Resource Centers, Information obtained from the Mutant Mouse Regional Resource Centers (MMRRC). Unpublished. 2004-2015;
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/24/2026
MGI 6.24
The Jackson Laboratory