About   Help   FAQ
Alas2em5Mdf
Endonuclease-mediated Allele Detail
Summary
Symbol: Alas2em5Mdf
Name: aminolevulinic acid synthase 2, erythroid; endonuclease-mediated mutation 5, Mark D Fleming
MGI ID: MGI:7780124
Synonyms: Alas2 del2AA, Alas2 Y175_P176del
Gene: Alas2  Location: ChrX:149330443-149353614 bp, + strand  Genetic Position: ChrX, 68.46 cM
Alliance: Alas2em5Mdf page
Mutation
origin
Strain of Origin:  C57BL/6NCrl
Mutation
description
Allele Type:    Endonuclease-mediated (Not Applicable)
Mutation:    Intragenic deletion
 
Mutation details: Alas2 del2AA (Alas2 Y175_P176del) mice carry a 6 bp (2 aa) deletion in exon 5 of the X-linked mouse Alas2 gene. This allele was incidentally created during the targeting of Alas2em1Mdf. The deletion (c.523_528del; p.Tyr175_Pro176del) was introduced as part of homology directed repair (HDR) CRISPR/cas9 processes in C57BL/6NCrl blastocysts (sgRNA: GAAGTGTTGGGCAAAGGGGT). (J:358328)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Alas2 Mutation:  12 strains or lines available
References
Original:  J:358328 Ducamp S, et al., Murine models of erythroid 5ALA synthesis disorders and their conditional synthetic lethal dependency on pyridoxine. Blood. 2024 Sep 26;144(13):1418-1432
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/06/2026
MGI 6.24
The Jackson Laboratory