Alas2^em4Mdf
Endonuclease-mediated Allele Detail

Summary

• Symbol: Alas2^em4Mdf
• Name: aminolevulinic acid synthase 2, erythroid; endonuclease-mediated mutation 4, Mark D Fleming
• MGI ID: MGI:7780122
• Synonyms: Alas2 ins14, V550Efs
• Gene: Alas2 Location: ChrX:149330443-149353614 bp, + strand Genetic Position: ChrX, 68.46 cM
• Alliance: Alas2^em4Mdf page

Mutation origin

• Strain of Origin: C57BL/6NCrl

Mutation description

• Allele Type: Endonuclease-mediated (Not Applicable)
• Mutation: Insertion
• Mutation details: Alas2 ins14 mice carry a 14 bp insertion in exon 11 of the X-linked mouse Alas2 gene that creates a frameshift. This viable C-terminal mutation allele was incidentally created during the targeting of Alas2^em3Mdf. The insertion (c.1646_1647ins14 (CGAAGAAGTTAAGA), p.Val550Glufs*23) was introduced as part of non-homologous end joining (NHEJ) CRISPR/cas9 processes in C57BL/6NCrl blastocysts (sgRNA: GCATGTGTTTGACATTGCGC). (J:358328)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Alas2 Mutation: 12 strains or lines available

References

• Original: J:358328 Ducamp S, et al., Murine models of erythroid 5ALA synthesis disorders and their conditional synthetic lethal dependency on pyridoxine. Blood. 2024 Sep 26;144(13):1418-1432
• All: 1 reference(s)