About   Help   FAQ
Alas2em4Mdf
Endonuclease-mediated Allele Detail
Summary
Symbol: Alas2em4Mdf
Name: aminolevulinic acid synthase 2, erythroid; endonuclease-mediated mutation 4, Mark D Fleming
MGI ID: MGI:7780122
Synonyms: Alas2 ins14, V550Efs
Gene: Alas2  Location: ChrX:149330443-149353614 bp, + strand  Genetic Position: ChrX, 68.46 cM
Alliance: Alas2em4Mdf page
Mutation
origin
Strain of Origin:  C57BL/6NCrl
Mutation
description
Allele Type:    Endonuclease-mediated (Not Applicable)
Mutation:    Insertion
 
Mutation detailsAlas2 ins14 mice carry a 14 bp insertion in exon 11 of the X-linked mouse Alas2 gene that creates a frameshift. This viable C-terminal mutation allele was incidentally created during the targeting of Alas2em3Mdf. The insertion (c.1646_1647ins14 (CGAAGAAGTTAAGA), p.Val550Glufs*23) was introduced as part of non-homologous end joining (NHEJ) CRISPR/cas9 processes in C57BL/6NCrl blastocysts (sgRNA: GCATGTGTTTGACATTGCGC). (J:358328)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Alas2 Mutation:  12 strains or lines available
References
Original:  J:358328 Ducamp S, et al., Murine models of erythroid 5ALA synthesis disorders and their conditional synthetic lethal dependency on pyridoxine. Blood. 2024 Sep 26;144(13):1418-1432
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/06/2026
MGI 6.24
The Jackson Laboratory