About   Help   FAQ
Alas2em3Mdf
Endonuclease-mediated Allele Detail
Summary
Symbol: Alas2em3Mdf
Name: aminolevulinic acid synthase 2, erythroid; endonuclease-mediated mutation 3, Mark D Fleming
MGI ID: MGI:7780120
Synonyms: Alas2 R452H
Gene: Alas2  Location: ChrX:149330443-149353614 bp, + strand  Genetic Position: ChrX, 68.46 cM
Alliance: Alas2em3Mdf page
Mutation
origin
Strain of Origin:  C57BL/6NCrl
Mutation
description
Allele Type:    Endonuclease-mediated (Not Applicable)
Mutation:    Nucleotide substitutions
 
Mutation detailsA p.R452H (c.1355_1356delinsAT) mutation was introduced to exon 9 of the X-linked mouse Alas2 gene using homology directed repair (HDR) CRISPR/cas9 methodologies in C57BL/6NCrl blastocysts (sgRNA: GCATGTGTTTGACATTGCGC). PAM site was also changed during targeting with a linked c.522C>A (p.A174=). (J:358328)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Alas2 Mutation:  12 strains or lines available
References
Original:  J:358328 Ducamp S, et al., Murine models of erythroid 5ALA synthesis disorders and their conditional synthetic lethal dependency on pyridoxine. Blood. 2024 Sep 26;144(13):1418-1432
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/20/2026
MGI 6.24
The Jackson Laboratory