About   Help   FAQ
Polgem1Murr
Endonuclease-mediated Allele Detail
Summary
Symbol: Polgem1Murr
Name: polymerase (DNA directed), gamma; endonuclease-mediated mutation 1, Stephen Murray
MGI ID: MGI:7768132
Gene: Polg  Location: Chr7:79095979-79116110 bp, - strand  Genetic Position: Chr7, 45.04 cM, cytoband E
Alliance: Polgem1Murr page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Mutation
description
Allele Type:    Endonuclease-mediated (Conditional ready)
Mutation:    Insertion
 
Mutation detailsUsing CRISPR/Cas9 endonuclease-mediated genome editing, guide RNAs (RNAs (GTGGGAGGCGAATAGTAAAG and CTGTCTTCCCTAAAGACCGC) were selected to insert /loxP sites flanking exon 3 of the Polg gene.. (J:94077)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Polg Mutation:  60 strains or lines available
References
Original:  J:94077 Mutant Mouse Regional Resource Centers, Information obtained from the Mutant Mouse Regional Resource Centers (MMRRC). Unpublished. 2004-2015;
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/24/2026
MGI 6.24
The Jackson Laboratory