Polg^em1Murr
Endonuclease-mediated Allele Detail

Summary

• Symbol: Polg^em1Murr
• Name: polymerase (DNA directed), gamma; endonuclease-mediated mutation 1, Stephen Murray
• MGI ID: MGI:7768132
• Gene: Polg Location: Chr7:79095979-79116110 bp, - strand Genetic Position: Chr7, 45.04 cM, cytoband E
• Alliance: Polg^em1Murr page

Mutation origin

• Strain of Origin: C57BL/6NJ

Mutation description

• Allele Type: Endonuclease-mediated (Conditional ready)
• Mutation: Insertion
• Mutation details: Using CRISPR/Cas9 endonuclease-mediated genome editing, guide RNAs (RNAs (GTGGGAGGCGAATAGTAAAG and CTGTCTTCCCTAAAGACCGC) were selected to insert /loxP sites flanking exon 3 of the Polg gene.. (J:94077)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Polg Mutation: 59 strains or lines available

References

• Original: J:94077 Mutant Mouse Regional Resource Centers, Information obtained from the Mutant Mouse Regional Resource Centers (MMRRC). Unpublished. 2004-2015
• All: 1 reference(s)