Defb42em1(IMPC)J
Endonuclease-mediated Allele Detail
|
Symbol: |
Defb42em1(IMPC)J |
Name: |
defensin beta 42; endonuclease-mediated mutation 1, Jackson |
MGI ID: |
MGI:7768075 |
Gene: |
Defb42 Location: Chr14:63284445-63286052 bp, + strand Genetic Position: Chr14, 33.24 cM, cytoband C3
|
Alliance: |
Defb42em1(IMPC)J page
|
IMPC: |
Defb42 gene page |
|
Strain of Origin: |
C57BL/6NJ
|
Project Collection: |
IMPC
|
|
Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
Mutation: |
|
Intragenic deletion
|
|
|
Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences: GGAGAGCCCAGCTTCTATAG and CCGTTTCAAATTCACCTGTG. This resulted in a 1,203 bp deletion of Chr14:63,047,434-63,048,636 (GRCm38/mm10) that removes exons ENSMUSE00001280806 and/through ENSMUSE00000446611.
(J:188991)
|
Inheritance: |
|
Not Specified |
|
|
Mouse strains and cell lines
available from the International Mouse Strain Resource
(IMSR) |
Carrying this Mutation: |
Mouse Strains: 0 strains available
Cell Lines: 0 lines available
|
Carrying any Defb42 Mutation: |
4 strains or lines available
|
|
Original: |
J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012; |
All: |
1 reference(s) |
|