About   Help   FAQ
Cdk2ap1rtem1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Cdk2ap1rtem1(IMPC)J
Name: cyclin dependent kinase 2 associated protein 1 retrotransposed; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:7768066
Gene: Cdk2ap1rt  Location: Chr11:48716173-48717439 bp, - strand  Genetic Position: Chr11, 28.8 cM
Alliance: Cdk2ap1rtem1(IMPC)J page
IMPC: Cdk2ap1rt gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences: GGATGCCCAACAGCACTCAC and GAAAAACTTTGGCAAGTTGC. This resulted in a 1,453 bp deletion of Chr11:48,825,274-48,826,726 (GRCm38/mm10) that removes exon ENSMUSE00000665110. (J:188991)
Inheritance:    Not Specified
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Cdk2ap1rt Mutation:  5 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
12/30/2025
MGI 6.24
The Jackson Laboratory