About   Help   FAQ
Cbr1bem1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Cbr1bem1(IMPC)J
Name: carbonyl reductase 1B; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:7763981
Gene: Cbr1b  Location: Chr16:93424985-93427339 bp, + strand  Genetic Position: Chr16, 54.54 cM
Alliance: Cbr1bem1(IMPC)J page
IMPC: Cbr1b gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences: GACATGGCTGCGTGTTCCTA and CAGCAAGTCTGGATATAAGG. This resulted in a 2,287 bp deletion of Chr16:93,628,085-93,630,371 (GRCm38/mm10) that removes exons ENSMUSE00000720738, ENSMUSE00001039070 and ENSMUSE00000714002. (J:188991)
Inheritance:    Not Specified
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Cbr1b Mutation:  5 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
12/30/2025
MGI 6.24
The Jackson Laboratory