Mafb^em4Lutzy
Endonuclease-mediated Allele Detail

Summary

• Symbol: Mafb^em4Lutzy
• Name: MAF bZIP transcription factor B; endonuclease-mediated mutation 4, Cathy Lutz
• MGI ID: MGI:7738390
• Synonyms: Mafb(WT)
• Gene: Mafb Location: Chr2:160205623-160208985 bp, - strand Genetic Position: Chr2, 80.92 cM
• Alliance: Mafb^em4Lutzy page

Mutation origin

• Strain of Origin: C57BL/6J

Mutation description

• Allele Type: Endonuclease-mediated (Humanized sequence)
• Mutation: Nucleotide substitutions
• Mutation details: Using CRISPR/Cas9 endonuclease-mediated genome editing, guide RNAs (TGGCCGCGGAGCTGAGCATG and TGCGGGCGGCAACGGTAGTG) were selected to excise and replace murine amino acids 5-202 in exon 1 of the MAF bZIP transcription factor B (Mafb) gene, on chromosome 2, with human wildtype amino acids 5-202 of MAFB (MAFB-201; ENST00000373313.3) exon 1. (J:94077)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Mafb Mutation: 20 strains or lines available

References

• Original: J:94077 Mutant Mouse Regional Resource Centers, Information obtained from the Mutant Mouse Regional Resource Centers (MMRRC). Unpublished. 2004-2015
• All: 1 reference(s)