About   Help   FAQ
Mafbem1Lutzy
Endonuclease-mediated Allele Detail
Summary
Symbol: Mafbem1Lutzy
Name: MAF bZIP transcription factor B; endonuclease-mediated mutation 1, Cathy Lutz
MGI ID: MGI:7738389
Synonyms: Mafb(P71R)
Gene: Mafb  Location: Chr2:160205623-160208985 bp, - strand  Genetic Position: Chr2, 80.92 cM
Alliance: Mafbem1Lutzy page
Mutation
origin
Strain of Origin:  C57BL/6J
Mutation
description
Allele Type:    Endonuclease-mediated (Humanized sequence)
Mutation:    Nucleotide substitutions
 
Mutation detailsUsing CRISPR/Cas9 endonuclease-mediated genome editing, guide RNAs (TGGCCGCGGAGCTGAGCATG and GCGACGGCTGCGGGCGGCAA) were selected to excise and replace murine amino acids 5-202 in exon 1 of the MAF bZIP transcription factor B (Mafb) gene, on chromosome 2, with human amino acids 5-202 of MAFB (MAFB-201; ENST00000373313.3) exon 1 with the P71R (CCC to CGC) missense variant. (J:94077)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Mafb Mutation:  22 strains or lines available
References
Original:  J:94077 Mutant Mouse Regional Resource Centers, Information obtained from the Mutant Mouse Regional Resource Centers (MMRRC). Unpublished. 2004-2015;
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/24/2026
MGI 6.24
The Jackson Laboratory