Gt(ROSA)26Sor^{em1(CAG-TFRC/OVA)Calic}
Endonuclease-mediated Allele Detail

Summary

• Symbol: Gt(ROSA)26Sor^{em1(CAG-TFRC/OVA)Calic}
• Name: gene trap ROSA 26, Philippe Soriano; endonuclease-mediated mutation 1, Calico Life Sciences
• MGI ID: MGI:7734987
• Synonyms: Rosa26^LSL-OVA-Luc
• Gene: Gt(ROSA)26Sor Location: Chr6:113044389-113054205 bp, - strand Genetic Position: Chr6, 52.73 cM
• Alliance: Gt(ROSA)26Sor^{em1(CAG-TFRC/OVA)Calic} page

Mutation origin

• Strain of Origin: C57BL/6J

Mutation description

• Allele Type: Endonuclease-mediated (Conditional ready, Reporter)
• Mutation: Insertion
• Mutation details: Using CRISPR/Cas9 endonuclease-mediated genome editing, guide RNAs (ACTGGAGTTGCAGATCACGA and GCAGATCACGAGGGAAGAGG) were used to insert a CMV-IE enhancer/chicken beta-actin/rabbit beta-globin hybrid promoter (CAG), a loxP-flanked STOP cassette, residues 2-118 of the human transferrin receptor (TFRC) fused to residues 139-387 of the ovalbumin gene, a bovine growth hormone polyadenylation signal (bGHpolyA), a 2A self-cleaving peptide and luciferase gene into the Gt(ROSA)26Sor locus on Chromosome 6. The sgRNAs, ssDNA (repair template), and the cas9 nuclease mRNA were introduced into the cytoplasm of zygotes derived from C57BL/6J. (J:352923)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Gt(ROSA)26Sor Mutation: 1062 strains or lines available

References

• Original: J:352923 Zhang J, et al., An immune-based tool platform for in vivo cell clearance. Life Sci Alliance. 2023 Aug;6(8)
• All: 1 reference(s)