Eif3l^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Eif3l^em1(IMPC)J
• Name: eukaryotic translation initiation factor 3, subunit L; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:7720862
• Gene: Eif3l Location: Chr15:78959423-78978600 bp, + strand Genetic Position: Chr15, 37.7 cM
• Alliance: Eif3l^em1(IMPC)J page
• IMPC: Eif3l gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences: CTGTTCACTGATCCAATAGG and ATACAAAGCATCTTTAGACG. This resulted in a 1,289 bp deletion of Chr15:79,077,860-79,079,148 (GRCm38/mm10) that removes exons ENSMUSE00000227221 and ENSMUSE00000227215. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Eif3l Mutation: 47 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 1 reference(s)