Slc68a1^em1(IMPC)Mbp
Endonuclease-mediated Allele Detail

Summary

• Symbol: Slc68a1^em1(IMPC)Mbp
• Name: solute carrier family 68 member 1; endonuclease-mediated mutation 1, Mouse Biology Program, UC Davis
• MGI ID: MGI:7715165
• Gene: Slc68a1 Location: Chr19:46345315-46363693 bp, + strand Genetic Position: Chr19, 38.82 cM, cytoband D1
• Alliance: Slc68a1^em1(IMPC)Mbp page
• IMPC: Slc68a1 gene page

Mutation origin

• Strain of Origin: C57BL/6NCrl
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at University of California, Davis using Cas9 and guides with spacer sequences ATACACTTAGCGGCTGCCGT and GGGTTGACCCTAGTGTGACA that targeted exon(s) ENSMUSE00001279320.2 ENSMUSE00001593543.1. This resulted in deletion(s) of 51 bp (location: Chr19:46356056-46356106; GRCm39), 403 bp (location: Chr19:46355482-46355884; GRCm39). This description was generated automatically. Additional molecular information including FASTA sequence support for this allele can be found here: (IMPC Gene page) and viewed in a genome context here: (IMPC Genome Browser). (J:384794)

• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Slc68a1 Mutation: 66 strains or lines available

References

• Original: J:265051 MGI and IMPC, MGI Load of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). Database Release. 2018-2023
• All: 2 reference(s)