Tg(Taar4-Venus)HD2Tboz
Transgene Detail

Summary

• Symbol: Tg(Taar4-Venus)HD2Tboz
• Name: transgene insertion HD2, Thomas Bozza
• MGI ID: MGI:7714927
• Synonyms: 5xHD-deltaT4YFPtg
• Transgene: Tg(Taar4-Venus)HD2Tboz Location: unknown
• Alliance: Tg(Taar4-Venus)HD2Tboz page

Transgene origin

• Strain of Origin: C57BL/6J

Transgene description

• Transgene Type: Transgenic (Reporter)
• Mutation: Insertion
• Mutation details: The transgene contains the following elements: ~2.3 kb sequence from upstream of the Taar4 TSS with 5 copies of homeodomain sequence ACATAACTTTTTAATGAGTCT inserted ~2 kb upstream of the TSS, the 5' UTR exons and intron, the Venus reporter gene (including Kozak sequence GCCACCATG upstream; replaces Taar4 CDS) and 1.3 kb sequence from downstream of the Taar4 CDS. (J:343906)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available

References

• Original: J:343906 Shah A, et al., Olfactory expression of trace amine-associated receptors requires cooperative cis-acting enhancers. Nat Commun. 2021 Jun 18;12(1):3797
• All: 1 reference(s)