About   Help   FAQ
Ccdc150em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Ccdc150em1(IMPC)J
Name: coiled-coil domain containing 150; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:7714692
Gene: Ccdc150  Location: Chr1:54289842-54407886 bp, + strand  Genetic Position: Chr1, 27.06 cM, cytoband C1
Alliance: Ccdc150em1(IMPC)J page
IMPC: Ccdc150 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences: GGAGTGCACCAAATAAGCCC and CTTCTAGTCGAGATAGAGCA. This resulted in a 707 bp deletion of Chr1:54,263,282-54,263,988 (GRCm38/mm10) that removes exons ENSMUSE00001296518 and ENSMUSE00001220531. (J:188991)
Inheritance:    Not Specified
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Ccdc150 Mutation:  64 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/28/2026
MGI 6.24
The Jackson Laboratory