Kcnq2em5Lutzy
Endonuclease-mediated Allele Detail
|
|
| Symbol: |
Kcnq2em5Lutzy |
| Name: |
potassium voltage-gated channel, subfamily Q, member 2; endonuclease-mediated mutation 5, Cathy Lutz |
| MGI ID: |
MGI:7714664 |
| Synonyms: |
KCNQ2 E254fs |
| Gene: |
Kcnq2 Location: Chr2:180717372-180777093 bp, - strand Genetic Position: Chr2, 103.57 cM, cytoband H3-4
|
| Alliance: |
Kcnq2em5Lutzy page
|
|
|
|
| Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
| Mutation: |
|
Intragenic deletion
|
| |
|
Mutation details: The allele was generated using CRISPR/Cas9 endonuclease-mediated genome editing. Guide RNAs (CTGGTGTACTTGGCAGAAAA and TCTGGTGTACTTGGCAGAAA) were used to target the potassium voltage-gated channel, subfamily Q, member 2 (Kcnq2) gene resulting in a frameshifting indel E254fs*16 mutation (deletion of the AAAGGG nucleotides. Donor DNAs were originally designed to introduce a G256W mutation Kcnq2em4Lutzy. DNA sequencing of the targeted region identified a single founder female that carried the desired G256W mutation in trans to a frameshifting indel E254fs*16 mutation (deletion of the AAAGGGG 7 nucleotides overlapping with the PAM sequence).
(J:364985)
|
|
|
| Mouse strains and cell lines
available from the International Mouse Strain Resource
(IMSR) |
| Carrying this Mutation: |
Mouse Strains: 0 strains available
Cell Lines: 0 lines available
|
| Carrying any Kcnq2 Mutation: |
49 strains or lines available
|
|
| Original: |
J:364985 Abreo TJ, et al., Plural molecular and cellular mechanisms of pore domain KCNQ2 encephalopathy. Elife. 2025 Jan 6;13 |
| All: |
1 reference(s) |
|