About   Help   FAQ
Kcnq2em4Lutzy
Endonuclease-mediated Allele Detail
Summary
Symbol: Kcnq2em4Lutzy
Name: potassium voltage-gated channel, subfamily Q, member 2; endonuclease-mediated mutation 4, Cathy Lutz
MGI ID: MGI:7714662
Synonyms: KCNQ2 G256W
Gene: Kcnq2  Location: Chr2:180717372-180777093 bp, - strand  Genetic Position: Chr2, 103.57 cM, cytoband H3-4
Alliance: Kcnq2em4Lutzy page
Mutation
origin
Strain of Origin:  C57BL/6J
Mutation
description
Allele Type:    Endonuclease-mediated (Humanized sequence)
Mutation:    Nucleotide substitutions
 
Mutation detailsThe allele was generated using CRISPR/Cas9 endonuclease-mediated genome editing. Guide RNAs (CTGGTGTACTTGGCAGAAAA and TCTGGTGTACTTGGCAGAAA) and a single stranded oligo donor, carrying two nucleotide differences to change the glycine GGT codon to a tryptophan TGG codon (G256W), were used to target the potassium voltage-gated channel, subfamily Q, member 2 (Kcnq2) gene. Donor DNAs were originally designed to introduce a G256W mutation. DNA sequencing of the targeted region identified a single founder female that carried the desired G256W mutation in trans to a frameshifting indel E254fs*16 mutation (deletion of the AAAGGG nucleotides overlapping with the PAM sequence) Kcnq2em5Lutzy. (J:364985)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Kcnq2 Mutation:  48 strains or lines available
References
Original:  J:364985 Abreo TJ, et al., Plural molecular and cellular mechanisms of pore domain KCNQ2 encephalopathy. Elife. 2025 Jan 6;13
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/18/2025
MGI 6.24
The Jackson Laboratory