Kcnq2^em4Lutzy
Endonuclease-mediated Allele Detail

Summary

• Symbol: Kcnq2^em4Lutzy
• Name: potassium voltage-gated channel, subfamily Q, member 2; endonuclease-mediated mutation 4, Cathy Lutz
• MGI ID: MGI:7714662
• Synonyms: KCNQ2 G256W
• Gene: Kcnq2 Location: Chr2:180717372-180777093 bp, - strand Genetic Position: Chr2, 103.57 cM, cytoband H3-4
• Alliance: Kcnq2^em4Lutzy page

Mutation origin

• Strain of Origin: C57BL/6J

Mutation description

• Allele Type: Endonuclease-mediated (Humanized sequence)
• Mutation: Nucleotide substitutions
• Mutation details: The allele was generated using CRISPR/Cas9 endonuclease-mediated genome editing. Guide RNAs (CTGGTGTACTTGGCAGAAAA and TCTGGTGTACTTGGCAGAAA) and a single stranded oligo donor, carrying two nucleotide differences to change the glycine GGT codon to a tryptophan TGG codon (G256W), were used to target the potassium voltage-gated channel, subfamily Q, member 2 (Kcnq2) gene. Donor DNAs were originally designed to introduce a G256W mutation. DNA sequencing of the targeted region identified a single founder female that carried the desired G256W mutation in trans to a frameshifting indel E254fs*16 mutation (deletion of the AAAGGG nucleotides overlapping with the PAM sequence) Kcnq2^em5Lutzy. (J:364985)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Kcnq2 Mutation: 48 strains or lines available

References

• Original: J:364985 Abreo TJ, et al., Plural molecular and cellular mechanisms of pore domain KCNQ2 encephalopathy. Elife. 2025 Jan 6;13
• All: 1 reference(s)