About   Help   FAQ
Cthrc1em1(cre/ERT2)Rph
Endonuclease-mediated Allele Detail
Summary
Symbol: Cthrc1em1(cre/ERT2)Rph
Name: collagen triple helix repeat containing 1; endonuclease-mediated mutation 1, Richard P Harvey
MGI ID: MGI:7712823
Synonyms: Cthrc1-creERT2
Gene: Cthrc1  Location: Chr15:38940327-38950516 bp, + strand  Genetic Position: Chr15, 15.35 cM, cytoband C
Alliance: Cthrc1em1(cre/ERT2)Rph page
Mutation
origin
Strain of Origin:  C57BL/6J
Mutation
description
Allele Type:    Endonuclease-mediated (Inducible, Recombinase)
Inducer:    tamoxifen
Mutation:    Insertion
 
Cthrc1em1(cre/ERT2)Rph expression driven by 1 gene
 
Mutation detailssgRNAs (TCTAGGGATCCACGTTGAAAAGG and GCAGGGACTGAAATCGTCAGAGG) were designed insert a cre/ER(T2) fusion gene (a Cre recombinase fused to a human estrogen receptor ligand binding domain) immediately before the native STOP codon in the last exon (exon 4) of the collagen triple helix repeat containing 1 (Cthrc1) gene (based on Cthrc1-201 ENSMUST00000067072.5). Additionally, two guanines in the PAM sites were mutated to cytosines in intron 4, downstream of the 3' UTR. (J:101977, J:353336)
Recombinase
activity
Activity:
 Tissue activity of this recombinase allele
Driver: Cthrc1 (mouse)
Summary of all recombinase alleles driven by Cthrc1.
 

Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Cthrc1 Mutation:  34 strains or lines available
References
Original:  J:353336 Janbandhu V, et al., Novel Mouse Model for Selective Tagging, Purification, and Manipulation of Cardiac Myofibroblasts. Circulation. 2024 Jun 11;149(24):1931-1934
All:  2 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/24/2026
MGI 6.24
The Jackson Laboratory