Nup107^{em1(DhaA*)Wtd}
Endonuclease-mediated Allele Detail

Summary

• Symbol: Nup107^{em1(DhaA*)Wtd}
• Name: nucleoporin 107; endonuclease-mediated mutation 1, William T Dauer
• MGI ID: MGI:7712790
• Synonyms: Nup107^KI
• Gene: Nup107 Location: Chr10:117586526-117628607 bp, - strand Genetic Position: Chr10, 66.32 cM
• Alliance: Nup107^{em1(DhaA*)Wtd} page

Mutation origin

• Strain of Origin: C57BL/6J

Mutation description

• Allele Type: Endonuclease-mediated (Epitope tag, Inserted expressed sequence)
• Mutation: Insertion
• Mutation details: A sgRNA (gagcgagcgccgagaagacccgg) was designed to insert a HaloTag with a short linker and TEV (tobacco etch virus nuclear-inclusion-a endopeptidase) site immediately upstream of the start codon of the nucleoporin 107 (Nup107) gene. HaloTag is a 33 kDa haloalkane dehalogenase encoded by the DhaA gene from Rhodococcus rhodochrous that has been mutagenized to form an irreversible covalent bond to synthetic chloroalkane ligands. (J:101977, J:353324)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Nup107 Mutation: 47 strains or lines available

References

• Original: J:353324 Kim S, et al., TorsinA is essential for neuronal nuclear pore complex localization and maturation. Nat Cell Biol. 2024 Aug 8
• All: 2 reference(s)