Del(2Rr366694-Rr513)1Ndav
Endonuclease-mediated Allele Detail

Summary

• Symbol: Del(2Rr366694-Rr513)1Ndav
• Name: deletion, Chr 2, Nadav Ahituv 1
• MGI ID: MGI:7711747
• Synonyms: Xe1+PEC7 KO
• Gene: Del(2Rr366694-Rr513)1Ndav Location: unknown Genetic Position: Chr2, Syntenic

Mutation origin

• Strain of Origin: Not Applicable

Mutation description

• Allele Type: Endonuclease-mediated (Modified regulatory region)
• Mutation: Intergenic deletion
• Mutation details: The two adjacent Pax1 enhancers Xe1 and PEC7 were targeted using sgRNAs (equivalent to GAACTTAAGTGGTGGAGTCGAGG and TGATACTGTCCATAAACCTCAGG) with CRISPR/Cas9 technology, resulting in ~9 kb deletions. Three strains were produced with the following deletions: GRCm39:chr2:147401674-147410709 (45-A), 147401674-147410713 (57-B), 147401678-147410715 (57-C). (J:346374)

Expression

In Mice Carrying this Mutation:

22 assay results

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Del(2Rr366694-Rr513)1Ndav Mutation: 0 strains or lines available

References

• Original: J:346374 Ushiki A, et al., Deletion of Pax1 scoliosis-associated regulatory elements leads to a female-biased tail abnormality. Cell Rep. 2024 Mar 8;43(3):113907
• All: 1 reference(s)