Del(2Rr366694-Rr513)1Ndav
Endonuclease-mediated Allele Detail
|
|
| Symbol: |
Del(2Rr366694-Rr513)1Ndav |
| Name: |
deletion, Chr 2, Nadav Ahituv 1 |
| MGI ID: |
MGI:7711747 |
| Synonyms: |
Xe1+PEC7 KO |
| Gene: |
Del(2Rr366694-Rr513)1Ndav Location: unknown Genetic Position: Chr2, Syntenic
|
|
| Strain of Origin: |
Not Applicable
|
|
| Allele Type: |
|
Endonuclease-mediated (Modified regulatory region) |
| Mutation: |
|
Intergenic deletion
|
|
|
Del(2Rr366694-Rr513)1Ndav involves 2 genes/genome features (Rr366694, Rr513)
View all
|
| |
|
Mutation details:
The two adjacent Pax1 enhancers Xe1 and PEC7 were targeted using sgRNAs (equivalent to GAACTTAAGTGGTGGAGTCGAGG and TGATACTGTCCATAAACCTCAGG) with CRISPR/Cas9 technology, resulting in ~9 kb deletions. Three strains were produced with the following deletions: GRCm39:chr2:147401674-147410709 (45-A), 147401674-147410713 (57-B), 147401678-147410715 (57-C).
(J:346374)
|
|
|
|
|
| Mouse strains and cell lines
available from the International Mouse Strain Resource
(IMSR) |
| Carrying this Mutation: |
Mouse Strains: 0 strains available
Cell Lines: 0 lines available
|
| Carrying any Del(2Rr366694-Rr513)1Ndav Mutation: |
0 strains or lines available
|
|
| Original: |
J:346374 Ushiki A, et al., Deletion of Pax1 scoliosis-associated regulatory elements leads to a female-biased tail abnormality. Cell Rep. 2024 Mar 8;43(3):113907 |
| All: |
1 reference(s) |
|